ORF finder: open reading frames in all six frames
An ORF finder scans a DNA sequence for open reading frames: stretches that begin at an ATG start codon and run to the first in-frame stop codon. Aaron's Archive checks all six reading frames (three on each strand), lists every ORF longest first, and translates each one so you can see the protein it would make.
Long ORFs are the best sign of a coding region, because stop codons interrupt random sequence about every 21 codons.
What you get
- Every ORF of at least 30 bases (stop codon included) on both strands
- An ORF map along the sequence
- A table sorted longest first, with protein length, stop codon and the start of the translation
- A six-frame translation view
- Coordinates and frames reported along the sequence you entered
How to use it
- Open the Single tab and paste a DNA or RNA sequence.
- Press Run analysis.
- Open the ORF results and read the table from the top: the longest ORF is listed first.
Worked example
Paste the same 76-base sequence:
ATGGCTAAGCTTGAATTCGGATCCGCTAGCTGACTGATCGTAGCTAGGCTAAGCTTGGATCCAAGCTAGCTAATAAIt holds one ORF: frame +1, 33 bases from base 1, stop codon TGA, translating to the 10-residue protein MAKLEFGSAS.
Limits to know about
- Only
ATGis used as a start codon, and the standard genetic code is used. - Introns are not handled: for a eukaryotic gene use the mRNA or cDNA sequence, not genomic DNA.
- ORFs shorter than 30 bases are not listed.
Common questions
What is an open reading frame?
A run of codons from a start codon to a stop codon with no stop in between. The ORF guide explains the six frames and how to judge whether an ORF is a real gene.
Does it search both strands?
Yes. Three frames are read on the sequence you paste and three on its reverse complement.
Does it find ORFs that do not start with ATG?
No. Bacteria sometimes start at GTG or TTG; only ATG is searched here.
Are my sequences stored?
No. Sequences are processed in memory to produce your result and are not stored or logged. The privacy policy has the details, including what BLAST sends to NCBI and EMBL-EBI.