PCR primer design tool
Paste a DNA template and the primer design tool returns eight candidate forward and reverse primer pairs, ranked by score. Each primer shows its length, GC content and melting temperature, and each pair shows the product size, the Tm difference and checks for hairpins, self-dimers and primer-dimers.
It is a quick way to get a sensible starting pair; the primer design guide explains the rules behind the scores.
What you get
- Eight primer pairs, best first
- For each primer: sequence, length, GC % and Tm
- For each pair: product size, difference in Tm, and a total score
- Flags for hairpins, self-dimers and a dimer between the two primers
How to use it
- Open the Primers tab and paste a DNA template of at least 60 bases.
- Run the design.
- Compare the pairs: prefer similar Tm values, no flags, and the product size you need.
Worked example
For the first 400 bases of the KRAS coding sequence that the app uses in its examples, the top pair was:
| Sequence (5'→3') | Length | GC | Tm | |
|---|---|---|---|---|
| Forward | TAGGCAAGAGTGCCTTGACG | 20 | 55.0% | 56.5 °C |
| Reverse | TGAGCCTGTTTTGTGTCTACTGTT | 24 | 41.7% | 56.5 °C |
The product is 352 bp, the Tm difference is 0.0 °C, and no hairpin, self-dimer or primer-dimer was flagged.
Show the 400-base example template
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCACTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGLimits to know about
- The template must be at least 60 bases and at most 1,000,000 bases, made of A, C, G and T (or U).
- An RNA sequence is converted to cDNA, because primers are DNA oligos.
- Tm is for a perfectly matched primer at 50 mM monovalent salt and 250 nM oligo; magnesium is not modelled, so treat it as a starting point for your annealing temperature.
Common questions
What are forward and reverse primers?
The forward primer matches the start of the top strand; the reverse primer is the reverse complement of the end of the region. Together they bracket the DNA that PCR copies. The guide has a worked example.
What annealing temperature should I use?
A common starting point is 3–5 °C below the lower primer Tm, then optimise with a temperature gradient. See the melting temperature guide.
Why check for primer dimers?
Primers that bind each other use up primer and make a short product that competes with yours. The tool flags self-dimers, hairpins and a dimer between the pair.
Are my sequences stored?
No. Sequences are processed in memory to produce your result and are not stored or logged. The privacy policy has the details, including what BLAST sends to NCBI and EMBL-EBI.