Restriction site finder and restriction mapper
A restriction site finder shows where restriction enzymes cut your DNA. Paste a sequence and Aaron's Archive searches it for the recognition sites of 36 commonly used enzymes, including EcoRI, BamHI, HindIII, XhoI, NcoI, NotI and EcoRV. For each enzyme that cuts you get the site positions, the cut positions and the number of cuts.
Enzymes that cut exactly once are the useful ones when you plan a cloning step, and the count makes them easy to spot.
What you get
- A list of the enzymes that cut your sequence, with the site and the cut positions
- The number of times each enzyme cuts
- Cut positions from which fragment sizes follow by subtraction
- A note on each enzyme, such as "Cloning, common" or "Frequent cutter"
How to use it
- Open the Single tab and paste a DNA sequence.
- Press Run analysis.
- Open the restriction results and look for enzymes with a count of 1 (single cutters).
Worked example
Paste the 76-base sequence:
ATGGCTAAGCTTGAATTCGGATCCGCTAGCTGACTGATCGTAGCTAGGCTAAGCTTGGATCCAAGCTAGCTAATAASix enzymes in the library cut it: AluI 6 times, MboI 3 times, and BamHI, HindIII and NheI twice each. EcoRI cuts once (site GAATTC), so it splits the 76 bp molecule into a 13 bp and a 63 bp fragment. BamHI cuts twice, giving 19, 38 and 19 bp.
Limits to know about
- Only the enzymes in the built-in library of 36 are searched.
- An enzyme that cuts more than 2,000 times returns an evenly spaced sample of its sites; its count stays exact.
- The site search looks for the recognition sequence only; it does not model methylation.
Common questions
What is a recognition site?
The short DNA sequence an enzyme binds and cuts, for example GAATTC for EcoRI. The restriction mapping guide explains recognition sites, sticky and blunt ends.
How do I find enzymes that cut only once?
Look for a count of 1 in the results. A single cutter linearises a plasmid, which is the usual first step in cloning.
Does it work on RNA?
Enzymes cut DNA. If you paste RNA it is analysed as the equivalent DNA.
Are my sequences stored?
No. Sequences are processed in memory to produce your result and are not stored or logged. The privacy policy has the details, including what BLAST sends to NCBI and EMBL-EBI.