CRISPR guide RNA finder
Paste a target DNA sequence and the CRISPR guide finder lists candidate guide RNAs for SpCas9, SpCas9-NG, SaCas9 or Cas12a. Each guide shows its strand, position, PAM, cut site and GC content, flags that can make it work poorly, a check against near-identical sites in your own sequence, and a score with a tier from Excellent to Poor.
What you get
- Guides on both strands for four nucleases, each with its PAM and cut position
- GC content and flags such as poly-T, G runs, homopolymers, hairpins and low or high GC
- An off-target count within the pasted sequence (perfect matches and sites with up to 3 mismatches)
- A score and a tier (Excellent, Good, Fair or Poor), with the best 150 guides listed
- An option to limit the search to a region of your sequence
How to use it
- Open the CRISPR tab and paste your target DNA.
- Choose the enzyme and, if you want, a region.
- Run the search and start from the top-scoring guides.
Worked example
For the first 200 bases of the KRAS example sequence (see the 400-base sequence on the primer design page), SpCas9 finds 15 candidate guides: 11 on the plus strand and 4 on the minus strand, with 14 rated Excellent and 1 Fair.
The top guide is AAACTTGTGGTAGTTGGAGC with PAM TGG at bases 13–32, cutting after base 29 (three bases from the PAM), GC 45%, with no flags and no other matching sites in the sequence.
Limits to know about
- The sequence can be up to 500,000 bases and must be plain A, C, G and T.
- Off-target checking looks only inside the sequence you paste, not across a genome. Check promising guides against the genome of your organism before ordering.
- Scores are a ranking aid, not a prediction of editing efficiency.
Common questions
What is a PAM?
A short sequence next to the target that the nuclease needs to cut: NGG for SpCas9. The CRISPR guide explains PAMs for each enzyme and where they cut.
Does it check off-targets across the genome?
No. It counts near-identical sites only within the sequence you paste. For genome-wide off-targets use a tool that holds your genome.
Which enzymes are supported?
SpCas9 (NGG), SpCas9-NG, SaCas9 and Cas12a.
Are my sequences stored?
No. Sequences are processed in memory to produce your result and are not stored or logged. The privacy policy has the details, including what BLAST sends to NCBI and EMBL-EBI.